Real Decreto 637/2006, de 26 de mayo, por el que se establece el programa nacional de erradicación y control del hongo Fusarium Circinatum Niremberg et O'donnell.

Fecha de Entrada en Vigor:10 de Junio de 2006
Marginal:BOE-A-2006-10287
Sección:I - Disposiciones Generales
Emisor:Ministerio de Agricultura, Pesca y Alimentacion
Rango de Ley:Real Decreto
 
ÍNDICE
CONTENIDO

La enfermedad de los pinos, conocida en el mundo anglosajón como «pitch canker», provoca importantes pérdidas económicas en las producciones de numerosas especies de pinos y otras coníferas. La causa de la enfermedad es la actividad del hongo fitopatógeno Fusarium Circinatum Niremberg et O´donnell, cuyo teleomorfo es Giberella circinata, y hasta la fecha, la presencia de este organismo nocivo era desconocida en España.

Este hongo fitopatógeno tiene una elevada capacidad de diseminación a través del material forestal de reproducción, especialmente las semillas, la circulación de productos forestales, como la madera, y el concurso de insectos perforadores, como curculiónidos y escolítidos, que actúan como vectores de éste.

El organismo ha sido detectado principalmente en material forestal de reproducción de pino en el norte de la península ibérica y, sólo en algunas ocasiones, ha sido confirmada su presencia en masas forestales. Existe la sospecha de que pudiera estar presente en aquellos territorios en los que se encuentran importantes formaciones forestales de Pinus Radiata, especie altamente sensible al «pitch canker». En todos los casos confirmados se ha procedido a la erradicación de los focos.

Dado que se trata de un organismo nocivo cuya presencia no se conoce en el territorio de la Unión Europea, ha sido necesario adoptar medidas de salvaguardia de conformidad con lo establecido en el artículo 16.2 del Real Decreto 58/2005, de 21 de enero, por el que se adoptan medidas de protección contra la introducción y difusión en el territorio nacional y de la Comunidad Europea de organismos nocivos para las vegetales o productos vegetales, así como para la exportación y tránsito hacia países terceros.

En consecuencia, la necesaria armonización y coordinación del conjunto de actuaciones tendentes a la localización y erradicación del organismo nocivo en cuestión para eliminar cualquier riesgo de propagación, se alcanza con el establecimiento del presente programa nacional de erradicación y la calificación de utilidad pública de las medidas en él incluidas, de acuerdo con la Ley 43/2002, de 20 de noviembre, de Sanidad Vegetal y el Real Decreto 1190/1998, de 12 de junio, por el que se regulan los programas nacionales de erradicación o control de organismos nocivos de los vegetales aún no establecidos en el territorio nacional.

En la elaboración de este real decreto han sido consultadas las comunidades autónomas y las entidades representativas de los sectores afectados.

En su virtud, a propuesta de la Ministra de Agricultura, Pesca y Alimentación, de acuerdo con el Consejo de Estado y previa deliberación del Consejo de Ministros en su reunión del día 26 de mayo de 2006,

DISPONGO :

Artículo 1 Objeto.
  1. Este real decreto establece el programa nacional de erradicación y control de Fusarium Circinatum Niremberg et O´donnell en las especies de coníferas relacionadas en el anexo I, en lo sucesivo «especies sensibles», de acuerdo con las disposiciones del artículo 15.2 de la Ley 43/2002, de 20 de noviembre, de Sanidad Vegetal, y el Real Decreto 1190/1998, de 12 de junio, por el que se regulan los programas nacionales de erradicación o control de organismos nocivos de los vegetales aún no establecidos en el territorio nacional.

  2. En virtud del artículo 15.1 de la Ley 43/2002 se declaran de utilidad pública las medidas de salvaguardia incluidas en el programa y adoptadas en cumplimiento del artículo 16.2 del Real Decreto 58/2005, de 21 de enero, por el que se adoptan medidas de protección contra la introducción y difusión en el territorio nacional y de la Comunidad Europea de organismos nocivos para las vegetales o productos vegetales, así como para la exportación y tránsito hacia países terceros.

Artículo 2 Ámbito de aplicación.

El programa que se aprueba y las medidas de él dimanantes serán de aplicación en todo el territorio nacional.

Artículo 3 Obligaciones de los agentes implicados.
  1. Los recolectores, productores y proveedores de semillas, viveristas, agricultores, silvicultores, operadores de industrias de primera transformación de la madera, importadores y profesionales que ejerzan actividades relacionadas con la protección vegetal deberán notificar inmediatamente al órgano competente de la comunidad autónoma o, en el caso de importadores de terceros países, a la Dirección General de Agricultura del Ministerio de Agricultura, Pesca y Alimentación la existencia de vegetales o productos vegetales de las especies relacionadas en el anexo I de este real decreto con síntomas de Fusarium Circinatum Niremberg et O´donnell, en lo sucesivo «el organismo».

  2. Para los vegetales o productos vegetales de las especies sensibles, el plazo de conservación de los documentos a que se refiere la Orden de 17 de mayo de 1993, por la que se establecen las obligaciones a que están sujetos los productores, comerciantes e importadores de vegetales, productos vegetales y otros objetos, así como las normas detalladas para su inscripción en un registro oficial, se fija en dos años. Esta obligación afecta también a los particulares que hayan efectuado plantaciones con dichas especies.

  3. Los proveedores de semillas de especies sensibles deberán poder acreditar antes de la comercialización, mediante el análisis preceptivo de una muestra representativa que los lotes de semillas, están exentos del organismo. Tal obligación también afectará a aquellos viveristas que utilicen semilla obtenida a partir de recolecciones efectuadas por ellos mismos. El análisis de la semilla se realizará de acuerdo con el protocolo previsto en el anexo III en laboratorios oficialmente reconocidos por la autoridad competente de la comunidad autónoma.

  4. Las obligaciones contempladas en los apartados anteriores son de aplicación a las administraciones titulares y gestoras del sector implicado.

Artículo 4 Prospecciones y controles sistemáticos.
  1. Las comunidades autónomas efectuarán en sus respectivos ámbitos territoriales prospecciones y controles sistemáticos encaminados a descubrir la presencia del organismo sobre los vegetales, cultivados o espontáneos, y productos vegetales de las especies sensibles, con particular atención a las masas forestales y al material forestal de reproducción definido en el Real Decreto 289/2003, de 7 de marzo, sobre comercialización de los materiales forestales de reproducción.

  2. Las prospecciones y controles se realizarán bajo las siguientes condiciones:

    1. Consistirán en inspecciones visuales de una red permanente de puntos e itinerarios en masas forestales de las especies sensibles, en especial, de los materiales de base establecidos en el Real Decreto 289/2003, y, en su caso, el diagnóstico de laboratorio de las muestras de vegetales sospechosos de estar infectados por el organismo.

    2. Se llevará a cabo una especial vigilancia de los materiales forestales de reproducción implicados en la producción y comercialización de especies sensibles. La vigilancia consistirá, en su caso, no solo en inspecciones visuales, sino también en la recogida de muestras para su análisis de laboratorio. El análisis de la semilla se realizará de acuerdo con el protocolo previsto en el anexo III. Asimismo, se controlará el cumplimiento de la legislación vigente sobre los documentos que han de amparar a los vegetales o productos vegetales adquiridos o expedidos por los viveros.

    3. Se realizará al menos una prospección al año, localizada en el período más favorable para la detección visual de síntomas.

    4. Las comunidades autónomas establecerán las zonas en las que se haya comprobado la ausencia del organismo y, en su caso, delimitarán las zonas (en adelante «zonas demarcadas») que incluyan una parte en la que se haya comprobado la presencia del organismo y otra parte que actúe como zona de seguridad o tampón, de una anchura no inferior a un kilómetro.

  3. Asimismo, se realizarán prospecciones dirigidas en función del análisis epidemiológico que se realice en cada momento y modificables según las informaciones que se vayan obteniendo sobre los movimientos del material vegetal con riesgo de estar infectado o de las posibilidades de contaminación natural.

Artículo 5 Confirmación oficial y acciones inmediatas.
  1. Si, como consecuencia de los resultados de las prospecciones o de la comunicación prevista en el artículo 3, se confirmara la presencia de un foco inicial del organismo:

    1. En el caso de masas forestales, incluido el material de base para la producción de material forestal de reproducción, se tomarán las siguientes medidas:

      1. Se declarará contaminada la parcela o el lugar en el que se recogió la muestra y se adoptarán las medidas necesarias para eliminar el foco de contaminación del organismo y evitar su dispersión.

      2. Se procederá a la eliminación in situ del material vegetal afectado.

    2. En el caso de material forestal de reproducción, se declarará contaminado dicho material y se procederá a ordenar la destrucción inmediata del lote afectado. Los demás lotes, que formen parte del mismo lugar de producción y tengan posibilidades de contaminación, se declararán probablemente contaminados y se inmovilizarán hasta que la comunidad autónoma decida expresamente su destino en función de las investigaciones que se realicen al respecto.

  2. La comunidad autónoma recabará de los proveedores del material forestal de reproducción de los lotes afectados la información de las salidas efectuadas en los dos últimos años y se dará cuenta inmediatamente a las comunidades autónomas de destino y a la Dirección General de Agricultura del Ministerio de Agricultura, Pesca y Alimentación. Se inmovilizará el material forestal de reproducción recibido y, en su caso, el producido a partir de éste, así como el material probablemente contaminado, durante el tiempo necesario para investigar, mediante inspecciones visuales y análisis de laboratorio, su condición sanitaria. En función de los resultados, se tomarán las medidas que en esta disposición se establecen para cada caso.

  3. La destrucción del material infectado se efectuará de forma inmediata por el propietario del mismo y bajo control oficial. Se realizará preferentemente en el rodal, la parcela o el establecimiento contaminado, por incineración o por cualquier otro método oficialmente reconocido. Se desinfectarán todas las instalaciones y medios que puedan haber sido contaminados en los procesos productivos.

  4. Las comunidades autónomas comunicarán inmediatamente a la Dirección General de Agricultura cualquier aparición confirmada del organismo en su territorio o en una parte de éste, en el cual su presencia no fuese conocida y las medidas adoptadas o previstas, así como los correspondientes análisis de los costes previstos.

Artículo 6 Medidas preventivas.

Tras la realización de las actuaciones inmediatas previstas en el artículo 5, se adoptarán las siguientes medidas preventivas:

  1. En el caso de masas forestales:

    1. Se establecerá una zona de seguridad o tampón alrededor del foco detectado, que quedará delimitada en función de los conocimientos sobre la epidemiología de la enfermedad y de los métodos de profilaxis específicos.

    2. Dicha zona de seguridad tendrá una anchura mínima de un kilómetro y en ella se efectuará un seguimiento intensivo en las épocas adecuadas.

    3. En la zona demarcada constituida por el foco detectado y la zona de seguridad se adoptarán las siguientes medidas:

      1. Tala y eliminación de la parte aérea cortada de todas las plantas de especies sensibles que presenten síntomas de la enfermedad y siguiendo los procedimientos establecidos en el artículo 5.1.a). Este hecho dará lugar al establecimiento de nuevas zonas de seguridad y la variación de los límites geográficos de la zona demarcada.

      2. En los casos en que sea factible, tratamiento preventivo contra los insectos vectores en las épocas de vuelo correspondientes con una materia activa apropiada que determinará la comunidad autónoma y tratamiento fungicida adecuado para prevenir la aparición del organismo.

      3. Prohibición de la salida de vegetales o productos vegetales, incluida la madera, de las especies sensibles fuera de la zona demarcada, sin perjuicio de lo establecido en el artículo 8.

      4. Prohibición de siembra, plantación o replantación de especies sensibles, mientras se mantenga la zona demarcada. La comunidad autónoma podrá autorizar la plantación de progenies y clones resistentes de las especies sensibles con fines de experimentación científica debidamente justificada.

      5. Obligatoriedad de desinfectar las herramientas de la explotación, especialmente las de corta y poda, después de efectuada la operación en cada ejemplar.

      6. Investigación epidemiológica del origen de la planta de especies sensibles en el caso de masas de repoblación artificial.

      7. En el caso de que en el interior de la zona demarcada existiese alguna instalación de material forestal de reproducción se declarará inicialmente probablemente contaminada y se inmovilizarán sus existencias del material sensible hasta que la comunidad autónoma decida expresamente su destino en función de las investigaciones que se realicen al respecto y según lo dispuesto en el artículo 8.2.

    4. La zona demarcada tendrá una vigencia mínima de dos años antes de considerar erradicado el foco siempre que durante este período no se hayan detectado nuevos brotes del organismo en ella.

  2. En el caso de parques de industrias de primera transformación e industrias que utilizan maderas sin elaborar, las comunidades autónomas en las que se confirme la presencia de parcelas contaminadas podrán elaborar un plan de actuación para todos los parques de madera situados en su territorio, en el que se determinarán la medidas necesarias para minimizar la dispersión del organismo, entre ellas, medidas para reducir las poblaciones de insectos que puedan actuar como vectores potenciales.

  3. En los demás casos, distintos de las masas forestales y parques de industrias de primera transformación e industrias que utilizan maderas sin elaborar, entre otros, instalaciones de material forestal de reproducción, como viveros, sequeros, y almacenes y centros de distribución de plantas y semillas:

    1. Se declarará contaminado el material que tras, los análisis procedentes, confirmen la existencia del organismo, al cual se aplicará lo dispuesto al respecto en el artículo 5.

    2. Se llevará a cabo una investigación epidemiológica del origen de todo el material de especies sensibles de la instalación susceptibles de contaminación. En su caso, si el origen del que presuntamente procede el material forestal de reproducción contaminado está ubicado en otra comunidad autónoma, se comunicará el hecho a dicha comunidad autónoma, para que ésta efectúe las oportunas inspecciones e indagaciones, o, si el material procede del extranjero, a la Dirección General de Agricultura para que ésta lo comunique al correspondiente país.

    3. Se investigarán los destinos de otros suministros efectuados por la entidad de procedencia del material de reproducción afectado como mínimo desde los 24 meses anteriores al de confirmación del foco inicial, para lo cual se remitirá la información obtenida a las comunidades autónomas de destino y a la Dirección General de Agricultura.

Artículo 7 Requisitos para la circulación de vegetales y productos vegetales de especies sensibles.
  1. A los vegetales y productos vegetales de las especies sensibles se les aplicarán las medidas fitosanitarias que en el Real Decreto 58/2005, de 21 de enero, son de aplicación a los vegetales y productos vegetales incluidos en:

    1. La sección II de la parte A del anexo II, respecto al organismo nocivo Fusarium Circinatum Niremberg et O´donnell.

    2. La parte A del anexo III respecto a los frutos y semillas originarios de terceros países en los que se sabe que el organismo está presente, relacionados en el anexo II de este real decreto.

    3. La sección II de la parte A del anexo IV, respecto a los vegetales y productos vegetales con el requisito especial de una declaración oficial de que:

      1. Los vegetales son originarios de una comunidad autónoma que, en aplicación de lo dispuesto en el artículo 4.2.e), se sabe está exenta de Fusarium Circinatum Niremberg et O´donnell.

      2. En el caso de comunidades autónomas en las que existen zonas demarcadas, no se ha observado ningún síntoma del organismo en el lugar de producción ni en sus alrededores inmediatos desde el inicio del último ciclo vegetativo completo.

      3. Los vegetales han sido inspeccionados inmediatamente antes de su puesta en circulación, no presentando señales del organismo.

    4. El apartado 1 de la sección I de la parte A del anexo V, que en el caso de la madera será exclusivamente de aplicación para los envíos que salgan de las zonas demarcadas a zonas distintas de éstas.

    5. La sección I de la parte B del anexo V, respecto a los frutos y semillas.

  2. Los proveedores de material forestal de reproducción de especies sensibles deberán registrarse de conformidad con lo dispuesto en la Orden de 17 de mayo de 1993, por la que se establecen las obligaciones a que están sujetos los productores, comerciantes e importadores de vegetales, productos vegetales y otros objetos, así como las normas detalladas para su inscripción en un registro oficial.

  3. Respecto al material forestal de reproducción de las especies sensibles, que está regulado en el Real Decreto 289/2003, de 7 de marzo, la etiqueta oficial definida en el mismo podrá utilizarse en lugar del pasaporte fitosanitario siempre que la misma aporte pruebas del cumplimiento de los requisitos a que se refiere el artículo 7.1 del Real Decreto 58/2005, de 21 de enero, y lo dispuesto en la Orden de 17 de mayo de 1993, por la que se establece la normalización de los pasaportes fitosanitarios destinados a la circulación de determinados vegetales, productos vegetales y otros objetos dentro de la Comunidad Europea, y por la que se establecen los procedimientos para la expedición de tales pasaportes y las condiciones y procedimientos para su sustitución.

Artículo 8 Requisitos para la circulación de vegetales y productos vegetales originarios de las zonas demarcadas.
  1. Las comunidades autónomas podrán establecer la excepción a lo dispuesto en el artículo 6.1.c). 3.º respecto a la prohibición de traslado de madera y productos de primera transformación de la misma desde las zonas demarcadas a zonas distintas de éstas, con la declaración oficial del cumplimiento de la condición consistente en que la madera y productos de primera transformación de la misma vayan acompañados por un pasaporte fitosanitario preparado y expedido de conformidad con el artículo 7.1 del Real Decreto 58/2005, de 21 de enero, y lo dispuesto en la Orden de 17 de mayo de 1993, por la que se establece la normalización de los pasaportes fitosanitarios destinados a la circulación de determinados vegetales, productos vegetales y otros objetos dentro de la Comunidad Europea, y por la que se establecen los procedimientos para la expedición de tales pasaportes y las condiciones y procedimientos para su sustitución, una vez que:

    1. Haya sido descortezada completamente, y

    2. Haya sido sometida a un tratamiento térmico adecuado de forma que la temperatura central de la madera alcance un mínimo de 56 ºC durante 30 minutos.

    Cuando las instalaciones donde se puedan realizar estas labores no existan en el interior de la zona demarcada, se podrá permitir el desplazamiento bajo control oficial de dicho material al punto más cercano de la comunidad autónoma donde realizarlas, adoptando las precauciones necesarias para evitar la diseminación del hongo y sus vectores durante el traslado y hasta el momento en que no exista peligro de propagación del organismo. En este caso, las instalaciones receptoras del material deberán estar autorizadas para realizar esta actividad e inscritas en un registro oficial establecido al respecto.

    En el caso de que el destino de la madera, una vez descortezada y sometida al tratamiento térmico, sea una comunidad autónoma distinta de la de origen del material, la autoridad competente de ésta comunicará a la autoridad competente de aquélla el destino y toda la información relativa al envío en cuestión para que se puedan efectuar los seguimientos y los controles que se estimen oportunos.

  2. Las comunidades autónomas podrán establecer la excepción a lo dispuesto en el artículo 6.1.c). 3.º respecto a la prohibición de traslado de vegetales probablemente contaminados desde las zonas demarcadas a zonas de su territorio distintas de éstas, con la declaración oficial del cumplimiento de la condición consistente en que los vegetales probablemente contaminados vayan acompañados por un pasaporte fitosanitario preparado y expedido de conformidad con el artículo 7.1 del Real Decreto 58/2005, de 21 de enero, y lo dispuesto en la Orden de 17 de mayo de 1993, por la que se establece la normalización de los pasaportes fitosanitarios destinados a la circulación de determinados vegetales, productos vegetales y otros objetos dentro de la Comunidad Europea, y por la que se establecen los procedimientos para la expedición de tales pasaportes y las condiciones y procedimientos para su sustitución, una vez que:

    1. Los vegetales hayan sido inspeccionados oficialmente encontrándose libres de síntomas y se haya comprobado con los análisis pertinentes que están libres de la enfermedad, y

    2. No se ha observado ningún síntoma en los alrededores inmediatos desde el inicio del último ciclo vegetativo completo.

Artículo 9 Coordinación.

La coordinación general del programa establecido en este real decreto se llevará a cabo a través del Comité Fitosanitario Nacional, creado por el Real Decreto 1190/1998, de 12 de junio, por el que se regulan los programas nacionales de erradicación o control de organismos nocivos de los vegetales aún no establecidos en el territorio nacional.

Con el fin de favorecer la coordinación técnica del programa, así como para evaluar las novedades científicas y técnicas que puedan ser incluidas en el mismo, dicho Comité podrá crear un Grupo de Trabajo de Expertos para la evaluación anual de los resultados obtenidos y elaboración de propuestas para su mejora.

Artículo 10 Medidas complementarias.

Además de las medidas establecidas en este real decreto, las comunidades autónomas podrán adoptar medidas complementarias que refuercen los efectos que se persiguen.

Artículo 11 Comunicación al Ministerio de Agricultura, Pesca y Alimentación.
  1. Sin perjuicio de las comunicaciones inmediatas previstas en los artículos 5 y 6 de este real decreto, las comunidades autónomas comunicarán a la Dirección General de Agricultura del Ministerio de Agricultura, Pesca y Alimentación antes del 1 de diciembre de cada año:

    1. Los resultados de las prospecciones sistemáticas previstas en el artículo 4.

    2. Las zonas en las que se haya comprobado la ausencia del organismo, delimitando sus límites cuando sea preciso.

    3. Las zonas demarcadas, en su caso, precisando los límites geográficos que las definen y detallando las masas forestales, explotaciones e instalaciones declaradas contaminadas; así como, entre otras informaciones relacionadas con el foco, los resultados de las investigaciones realizadas en cada caso para conocer el origen de la contaminación y las medidas de erradicación aplicadas.

    4. La información relativa a los gastos previstos y realizados como consecuencia de las medidas de erradicación aplicadas, de acuerdo con la regla sexta del artículo 86.2 de la Ley 47/2003, de 26 de noviembre, General Presupuestaria.

  2. La Dirección General de Agricultura elaborará un informe anual con los datos proporcionados por las comunidades autónomas, que incluirá la relación de zonas previstas en el apartado 1.b), que se enviará a la Dirección General para la Biodiversidad del Ministerio de Medio Ambiente y a las comunidades autónomas.

  3. La ausencia de información sobre la situación del organismo en un determinado territorio implicará su consideración, previo informe del Comité Fitosanitario Nacional, como zona demarcada a los efectos de este real decreto.

Artículo 12 Indemnizaciones.
  1. Será de aplicación, en su caso, el sistema de indemnizaciones previsto en el artículo 18 del Real Decreto 1190/1998.

  2. No son indemnizables, los gastos ocasionados ni el material vegetal destruido en aplicación de una medida oficial, cuando el propietario de los vegetales o productos vegetales haya incumplido la normativa vigente y, especialmente, lo determinado en el Real Decreto 58/2005.

  3. El Ministerio de Agricultura, Pesca y Alimentación, dentro de los límites establecidos por los créditos disponibles para estos fines, y sobre la base de la información proporcionada por las comunidades autónomas de conformidad con el artículo 11, colaborará con éstas en la financiación de hasta el 50 por ciento de los gastos correspondientes a las medidas obligatorias de erradicación establecidas en aplicación de este real decreto.

Disposiciones Finales
Disposición final primera Título competencial.

Este real decreto se dicta al amparo de lo dispuesto en el artículo 149.1.13.ª de la Constitución, que atribuye al Estado la competencia exclusiva en materia de bases y coordinación de la planificación general de la actividad económica.

Disposición final segunda Facultad de desarrollo.

Se faculta al Ministro de Agricultura, Pesca y Alimentación para dictar, en el ámbito de sus competencias, las disposiciones necesarias para el desarrollo de este real decreto y, en particular, para modificar los anexos cuando sea necesario, previo informe del Comité Fitosanitario Nacional.

Disposición final tercera Entrada en vigor.

El presente real decreto entrará en vigor el día siguiente al de su publicación en el «Boletín Oficial del Estado»

Dado en Madrid, el 26 de mayo de 2006.

JUAN CARLOS R.

La Ministra de Agricultura, Pesca y Alimentación,

ELENA ESPINOSA MANGANA

ANEXO I Coníferas sensibles a Fusarium circinatum Niremberg et O´donnell

Pinus spp.

ANEXO II Países terceros en los que se conoce la presencia de Fusarium circinatum Niremberg et O´donnell

Chile.

Estados Unidos.

Haití.

Irak.

Japón.

México.

Sudáfrica.

ANEXO III Protocolo para el diagnóstico de Fusarium circinatum Niremberg et O´donnell en semillas

El método que se establece para la detección de Fusarium circinatum Niremberg et O´donnell en semillas se ha elaborado teniendo en consideración el método ISTA para la detección de Fusarium moniliforme var. subglutinans en Pinus taeda y Pinus elliotii (2002).

Sin embargo, dado que las semillas no se esterilizan bajo riesgo de eliminar el patógeno buscado, existe la posibilidad de obtener falsos negativos debido a la contaminación por otras especies de Fusarium o al enmascaramiento por la presencia de otros hongos contaminantes. Por ello se considera importante la identificación del patógeno en cultivo puro. También se ha observado que el número de identificaciones positivas en partidas de semillas examinadas es muy bajo y por este motivo en el presente método se establece un mínimo de semillas a procesar superior al determinado por el método ISTA.

  1. Metodología

    Se procesarán 500 semillas de cada lote de acuerdo al siguiente método:

    1. Siembra directa de las semillas sin lavado ni esterilización previa en medios de cultivo PDAS (250 semillas) y Komada (250 semillas).

    2. Las placas se incubarán en la oscuridad a 25 ºC durante 4 semanas y se observarán periódicamente, repicando las colonias de Fusarium que vayan apareciendo a medio de cultivo PDA.

    3. Obtención de cultivos monospóricos de estas colonias.

    4. Identificación cultural y morfológica:

      1. Repicar cada cultivo monospórico a PDA para poder estudiar las características culturales y a SNA (Spezieller Nährstoffarmer Agar) y CLA (Carnation Leaf Agar) para estudiar las características morfológicas.

      2. Incubar las placas en estos medios de cultivo a 25 ºC en oscuridad durante 10 días, al cabo de los cuales se observa:

      1. En PDA, las características culturales: en el caso de Fusarium circinatum Niremberg et O´donnell se observarán colonias de micelio algodonoso de color blanco grisáceo a rosado o violeta.

      2. Observación bajo microscopio de las características morfológicas: en SNA se observará la presencia de microconidios e hifas estériles enrolladas, y en CLA se observará la presencia de los microconidios y los macroconidios. En el caso de Fusarium circinatum Niremberg et O´donnell se observarán los microconidios en polifiálidas, ausencia de cadenas de conidios, presencia de hifas estériles enrolladas y ausencia de clamidosporas.

    5. Identificación molecular:

      1. Realizar la extracción de ADN de los cultivos monospóricos de los aislados sospechosos morfológicamente.

      2. Seguir el protocolo de PCR descrito por Schweigkofler et al. (2004), donde, en caso positivo, se obtendrá un fragmento de 360 pb.

      Cebadores: CIRC1A (5´CTTGGCTCGAGAAGGG).
      CIRC4A (5´ACCTACCCTACACCTCTCACT).

      Condiciones: Desnaturalización a 94 ºC durante 180 segundos, seguida de 45 ciclos de 94 ºC durante 35 segundos, 66 ºC durante 55 segundos, y 72 ºC durante 50 segundos y con una extensión final de 72 ºC durante 12 minutos.

  2. Medios de cultivo

    1. Medio Komada (Komada, 1975).

      K2HPO4: 1,0 g.

      KCL: 500 mg.

      MgSO4· 7H2O: 500 mg.

      Fe-Na-EDTA: 10 mg.

      L-asparagina: 2,0 g.

      D-galactosa: 20,0 g.

      Agar: 15,0 g.

      Agua: 1,0 L.

      Autoclavar a 121 ºC durante 20 minutos y dejar enfriar un poco.

      Añadir la siguiente solución de suplementos previamente mezclados, esterilizados por filtración y con el pH bien ajustado a 3,8 ± 0,2 con una solución de ácido fosfórico al 10%.

      Pentacloronitrobenceno: 1,0 g (PNCB, 75 % WP).

      Oxgall: 500 mg.

      Na2B4O7· 10H2O: 1,0 g.

      Sulfato de estreptomicina: 300 mg.

    2. SNA (Spezieller-Nährstoffarmer Agar).

      KH2PO4: 1,0 g.

      KNO3: 1,0 g.

      MgSO4· 7H2O: 0,5 g.

      KCL: 0,5 g.

      Glucosa: 0,2 g.

      Sacarosa: 0,2 g.

      Agar Oxoid N.º 3: 20,0 g.

      Agua destilada: 1,0 L.

      Disolver todos los ingredientes excepto el agar. Ajustar el pH a 6 - 6,5. Añadir y disolver el agar. Autoclavar a 121 ºC durante 20 minutos.

    3. CLA (carnation leaf agar, agar de hoja de clavel).

      Agar: 20,0 g.

      Agua destilada: 1,0 L.

      Autoclavar a 121 ºC durante 20 minutos. Esterilizar las hojas de clavel a 121 ºC durante 20 minutos y colocarlas sobre la superficie del agar.

  3. Referencias

    KOMADA, H., 1975. Development of a selective medium for quantitative isolation of Fusarium oxysporum from natural soil. Rev. Plant Protec. Res. 8: 114-125.

    SCHWEIGKOFLER, W.; O´DONNELL, K. y GARBELOTTO, M., 2004. Detection and quantification of airborne conidia of Fusarium circinatum, the causal agent of pine pitch canker, from two California sites by using a real-time PCR approach combined with a simple spore trapping method. Applied and Environmental Microbiology 70, 2004, 3512-3520.

    7-009: Detection of Fusarium moniliforme var. subglutinans on Pinus spp. International Rules for Seed Testing. Annexe to Chapter 7: Seed Health Testing Methods. Published by: International Seed Testing Association (ISTA). Bassersdorf, Switzerland, 2002. p: 1-8.